Information about human SNPs in a region or from a list

Options selected:

If a chromosome region was specified, the NCBI eUtils interface to dbSNP will be used to find SNPs within that region. As of April 2010, this search will allow SNPs of Weight 1 or 2. If a region was specified, the search term used during the search will be displayed below.
The NCBI Entrez Neighbor SNP Popup will be used to find neighbor SNPs with Weight=1.
Clicking the "SNP Neighbor Popup" link in the left-hand column of the output display will invoke the NCBI Neighbor SNP Popup which will display neighbor SNPs of Weight=1.
FASTA records for each SNP will not be printed.
FLT records for each SNP will not be printed.
Full XML records for each SNP will not be printed.
Alternate SNP mappings to locations outside the specified target range may be displayed.
SNP IDs will be taken from the input list.

1 unique SNP IDs have been identified, and their detailed records will now be requested from NCBI.

The following table presents a form with checkboxes you can use to de-select SNPs of no interest, and then choose an option below the table for continued processing. (Please see the notes at the end of this document for assistance interpreting its content.)

SNP records

SNP SNP data from current, on-line NCBI sources

12913832 (mapping 1)

NCBI SNP Neighbor Popup

Organism	Taxon ID	SNP Build	Genome Build	Chromo- some	Position	Contig	Contig start	Contig end	Orientation	LocType code
Homo sapiens	9606	131	37_1	15	28365618	NT_026446.14	4800765	4800765	plus	True SNP; contig allele is one base long

SNP creation build	SNP creation date	Heterozygosity (if available)			SNP function class (from Reference Assembly)	Gene locus (from Reference Assembly)
		Type	Value	Standard Error
121	2009-12-04 14:37	est	0.360	0.226	intron	HERC2

Neighbor SNPs No neighbors were reported within 100 base positions of position 28365618 (using assembly=GRCh37). If this target SNP is an alternative mapping, no SNPs will be shown if the NCBI popup is being used to find Neighbor SNPs. Click the "SNP Neighbor Popup" link to verify SNPs of Weight 1 within range.

Exemplar sequence (5', SNP, 3') in plus orientation:

AAATCATGTGTTAATACAAAGGTACAGGAACAAAGAATTTGTTCTTCATGGCTCTCTGTGTCTGATCCAAGAGGCGAGGCCAGTTTCATTTGAGCATTAA

[A/G]

TGTCAAGTTCTGCACGCTATCATCATCAGGGGCCGAGGCTTCTCTTTGTTTTTAATTAATTGTTTTTAACTGTGAGTTTATATACACTTGAAGCAGTATA

Exemplar sequence (5', SNP, 3') in minus orientation:

TATACTGCTTCAAGTGTATATAAACTCACAGTTAAAAACAATTAATTAAAAACAAAGAGAAGCCTCGGCCCCTGATGATGATAGCGTGCAGAACTTGACA

[C/T]

TTAATGCTCAAATGAAACTGGCCTCGCCTCTTGGATCAGACACAGAGAGCCATGAAGAACAAATTCTTTGTTCCTGTACCTTTGTATTAACACATGATTT

Notes:

Neighbor SNP offset values are relative only to the position of a SNP on the reference chromosome; stream direction is irrelevant unless the SNP is being identified within a displayed sequence.
There may be multiple SNPs associated with the same location. As a result, there may be mulitple neighbor SNPs reported for the same offset in "Neighbor SNP" lists.
In the table above Neighbor SNP offset locations are counted differently for Exemplar sequences displayed in "plus" and "minus" orientations. For example, within an Exemplar sequence displayed in a plus orientation, positive offset locations are counted from left to right downstream into a 3' flanking region, and negative offset locations are counted right to left upstream into the 5' flanking region. For sequences displayed in a minus orientation, exchange the words "positive" and "negative" in the preceding sentence.
The orientation of the displayed allele sequences may not match the orientation of the displayed exemplar sequences with which they are associated. Also, they may or may not have been recorded with the same complementarity as the displayed Exemplar sequence.
Neighbor SNPs may map to more than one chromosome; their "weight" as recorded in dbSNP may be be greater than 2. All SNP neighbor searches are currently being conducted without regard to the number of locations to which a neighbor SNP maps.

Here is the table of SNP Function classes:

Function code	Abbreviation	Description
1	locus	mrna_acc and protein_acc both null.
2	coding	coding
3	cds-synon	synonymous change
4	cds-nonsynon	nonsynonymous change
5	UTR	untranslated region
6	intron	intron
7	splice-site	splice-site
8	cds-reference	contig reference
9	synonymy unknown	coding: synonymy unknown
11	GeneSegment	In gene segment with null mrna and protein. ex. IGLV4-69. geneId=28784
13	nearGene-3	within 3' 0.5kb to a gene.
15	nearGene-5	within 5' 2kb to a gene.
41	nonsense	changes to STOP codon.
42	missense	alters codon to make an altered amino acid in protein product.
44	frameshift	indel snp causing frameshift.
53	UTR-3	3 prime untranslated region
55	UTR-5	5 prime untranslated region
73	splice-3	3 prime acceptor dinucleotide
75	splice-5	5 prime donor dinucleotide

Here is the table of Locus Type Codes

code	abbrev	descrip
1	InsOnCtg	Insertion on contig: snp is always represented as one base and this one base in the snp sequence is substituted with more than one bases on the contig sequence in the alignment.
2	trueSNP	Contig allele is one base long.snp is always represented as one base and this one base in the snp sequence is substituted with exactly one base on the contig.
3	DelOnCtg	Deletion on the contig: part of the snp flanking sequence including the snp was absent on the contig sequence in the alignment.
4	LongerOnCtg	In the alignment, part of the snp flanking sequence including snp is replaced with the contig sequence of longer length.
5	EqualOnCtg	In the alignment, part of the snp flanking sequence including snp is replaced with the contig sequence of exactly the same length.
6	ShorterOnCtg	In the alignment, part of the snp flanking sequence including snp is replaced with the contig sequence of a shorter length.