A gene's building-block sequence is the precise order of
appearance, one after the other, of 4 different
components (deoxyribonucleotides) within a stretch of DNA
(deoxyribonucleic acid). The 4 components are: Adenine, Thymidine,
Cytosine and Guanine, abbreviated as: A, T, C and G, respectively (a
4-letter alphabet). The arrangement of the letters (one after the
other) of this 4-letter alphabet generates a "sentence" (a gene
sequence). The number of letters in the sentence may be relatively few,
or relatively many, depending on the gene. If the sentence is 1000
letters-long, the sequence would be said to be 1 kilobase (1000 bases).
As an example:
ATATCGGGTTAACCCCGGTATGTACGCTA would represent part of one gene.
DNA is double-stranded (except in some viruses), and the two strands
pair with one another in a very precise way. EACH letter in a
strand will
pair with only one kind of letter across from it in the opposing
strand: A ALWAYS pairs with T; and, C ALWAYS pairs with G across
the two strands.
So:
The first step for PCR would be to synthesize "primers" of
about 20 letters-long, using each of the 4 letters, and a machine which
can link the letters together in the order desired - this step is
easily done, by adding one letter-at-a-time to the machine (DNA
synthesizer).
In this example, the primers we wish to make will be exactly the same as
the flanking sequences shown above. We make ONE primer exactly like the
lower left-hand sequence, and ONE primer exactly like the upper
right-hand sequence, to generate:
TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT
AATTGCCCCGGGAAATTT.......................>
and:
<.....................................................TTTAAACCCGGGTTT
AATTGCCCCGGGAAATTT........AAATTTGGGCCCAAA
Now. the ........ may be a very long set of letters in-between; doesn't
matter. If you look at this arrangement, you can see that if the lower
left-hand primer sequence (italics) paired to the upper strand
could be extended to the right in
the direction of the arrow, and the upper right-hand sequence paired to
the lower
strand could be extended to the left in the direction of the arrow
(remembering that the ......... also represent letters, and opposite
pairing will ALWAYS be A to T and C to G), one could successfully exactly
duplicate the original gene's entire sequence. Now there would
be four strands,
where originally there were only two. If one leaves everything in
there, and repeats the procedure, now there will be eight strands, do
again - now 16, etc.. therefore, about 20 cycles will theoretically
produce approximately one-million copies of the original sequences (2
raised to the 20th power).
Thus, with this amplification potential, there is enough DNA in one-tenth of one-millionth of a liter (0.1 microliter) of human saliva (contains a small number of shed epithelial cells), to use the PCR system to identify a genetic sequence as having come from a human being! Consequently, only a very tiny amount of an organism's DNA need be available originally. Enough DNA is present in an insect trapped within 80 million year-old amber (fossilized pine resin) to amplify by this technique! Scientists have used primers which represent present-day insect's DNA, to do these amplifications.
Here is how PCR is performed:
First step: unknown DNA is heated, which causes the paired strands to
separate (single strands now accessible to primers).
Second step: add large excess of primers relative to the amount of DNA
being amplified, and cool the reaction mixture to allow
double-strands to form again (because of the large excess of primers, the two
strands will always bind to the primers, instead of with each
other).
Third step: to a mixture of all 4 individual letters
(deoxyribonucleotides), add an enzyme which can "read" the
opposing strand's "sentence" and extend the primer's
"sentence" by "hooking" letters together in the
order in which they pair across from one another - A:T and C:G. This
particular enzyme is called a DNA polymerase (because makes DNA
polymers). One such enzyme used in PCR is called
Taq polymerase (originally isolated from a bacterium that can live
in hot springs - therefore, can withstand the high temperature necessary
for DNA-strand separation, and can be left in the reaction).
Now, we have the enzyme synthesizing new DNA in opposite directions -
BUT ONLY THIS PARTICULAR REGION OF DNA.
After one cycle, add more primers, add 4-letter mixture, and repeat the
cycle. The primers will bind to the "old" sequences as well
as to the newly-synthesized
sequences. The enzyme will again extend primer sentences ... Finally,
there will be
PLENTY of DNA - and ALL OF IT will be copies of just this particular region.
Therefore, by using different primers which represent flanking regions
of different genes of
various organisms in SEPARATE experiments, one can determine if in fact,
any DNA has been amplified. If it has not, then the primers did not bind
to the DNA of the sample, and it is therefore highly unlikely that the
DNA of an organism which a given set of primers represents, is present.
On the other hand, appearance of DNA by PCR will allow precise
identification of
the source of the amplified material.
Book: Don't Touch That Doorknob!